What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Answered by Thomas D. Biology tutor

3133 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Both Fish and Mammals have ventilation mechanisms. Explain the function of ventilation mechanisms and name the muscles which operate the ventilation mechanism in mammals.


Explain the lock and key mechanism in relation to enzymes.


Interview


Which of these is a correctly balanced equation for respiration? C6H12O6 + 3O2 → CO2 + 3H2O C6H12O6 + 6O2 → 6CO2+ 6H2O C6H12O6 + 6O2 → 6CO2 + 3H2O


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2025

Terms & Conditions|Privacy Policy
Cookie Preferences