What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3187 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What is an enzyme and explain the factors affecting it.


Does water travel up or down the concentration gradient?


How does the body control blood sugar?


What's the difference between diffusion and osmosis?


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2025

Terms & Conditions|Privacy Policy
Cookie Preferences