What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD

Related Biology GCSE answers

All answers ▸

I'm not sure how to answer the longer-answered questions e.g. those that are 6 marks.


What is the function of the cell nucleus?


Why do bacteria become resistant to antibiotics?


What is Osmosis?