What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3608 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Describe the life cycle of a virus.


Describe how a synapse works to transmit a nervous impulse from one neuron to another neuron.


Describe how blood moves around the heart


Why are the walls of the left ventricle thicker than the walls of the right ventricle?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning