What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Answered by Thomas D. Biology tutor

3020 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What occurs during the metaphase stage of mitosis?


How would a reflex action take place?


what is the role of the pancreas in the digestion of fats, and the role of bile in this process


explain the circulation of blood pumped by the heart


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo
Cookie Preferences