What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Answered by Thomas D. Biology tutor

2941 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Explain how a population of antibiotic-resistant bacteria might develop from non-resistant bacteria.


What are the names given to the body's first and second line of defence against disease? Name an example for each and how it works to prevent disease.


Provide and explain one example of natural selection


Students placed some grass cuttings in a vacuum flask and attached a carbon dioxide sensor. Why would the carbon dioxide levels increase over a period of 20 days?


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo
Cookie Preferences