What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3635 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Mitosis is important in the life of a multi-cellular organism. Explain why and how mitosis works.


How many nucleotides code for an amino acid in protein synthesis?


Why do cells divide and how do they do this?


Describe the structure of the DNA of a eukaryotic cell


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning