What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

Answered by Thomas D. Biology tutor

2785 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

What are the four levels of protein structure?


What is the point of anerobic respiration?


Give 2 methods of transmission of disease and an example for each


Using a diagram, outline the path the blood takes through the human body, starting with the aorta and identifying the major vessels and chambers of the heart.


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2024

Terms & Conditions|Privacy Policy
Cookie Preferences