What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3641 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Give advantages and disadvantages of treating patients with an artificial heart.


Describe the key features of an exchange surface


Explain the key differences between plant and animal cells.


Tobacco Mosaic Virus (TMV) causes plants to produce less chlorophyll leading to discolouration of the leaves. Explain why plants infected with TMV have stunted growth.


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2026 by IXL Learning