What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3571 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Different enzymes catalyse specific reactions. Explain why enzymes can only catalyse specific reactions.


What are the differences between the nervous and endocrine systems in maintaining homeostasis?


What are the differences between diffusion, osmosis and active transport?


Describe the difference between the function of an effector and receptor, giving an example of each.


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

MyTutor is part of the IXL family of brands:

© 2025 by IXL Learning