What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3171 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

How can plasmids be used to create transgenic plants?


Define osmosis


What is a reflex action?


In the case of cystic fibrosis, two parents don't suffer from the disease but both carry the recessive cystic fibrosis allele. What is the probability that a child of the parents will suffer from cystic fibrosis.


We're here to help

contact us iconContact usWhatsapp logoMessage us on Whatsapptelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2025

Terms & Conditions|Privacy Policy
Cookie Preferences