What is the structure of DNA?

DNA is a double helix. Consisting of two strands, which are made up of bases A T C and G

Complementary base pairing occurs, where if part of one strand contains an A, the same part of the other strand contains a T. The same applies for and G.

Example:

ATTCGCCAAATTCCCCGATTGGG

TAAGCGGTTTAAGGGGCTAACCC

TD
Answered by Thomas D. Biology tutor

3268 Views

See similar Biology GCSE tutors

Related Biology GCSE answers

All answers ▸

Describe the steps in a reflex arc.


What is the process by which vaccines protect individuals against infectious diseases?


Describe the effect of temperature on enzyme activity.


What is diffusion and how is it different from osmosis?


We're here to help

contact us iconContact ustelephone icon+44 (0) 203 773 6020
Facebook logoInstagram logoLinkedIn logo

© MyTutorWeb Ltd 2013–2025

Terms & Conditions|Privacy Policy
Cookie Preferences